Basic information for LOC102556339-201-10aa-2
| Peptide Name | LOC102556339-201-10aa-2 |
| Genome Position | chrX:72711481-72711510[+] |
| Species | Rat |
| Peptide Sequence | MGLFKWFICS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.23 |
| Relative Molecular Mass | 1393.66 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000060509;LOC102556339 |
| Transcript ID/Name | ENSRNOT00000079320;LOC102556339-201 |
| Transcript Length | 6113 |
| Coding Ability | 0.407 |
| DNA Sequence Corresponding to Peptide | ATGGGGTTGTTTAAATGGTTTATCTGTTCC |
|
Conservation
|
|
|