Basic information for LOC108351524-201-10aa
| Peptide Name | LOC108351524-201-10aa |
| Genome Position | chr7:129412984-129413013[-] |
| Species | Rat |
| Peptide Sequence | MNGEDAITIV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.53 |
| Relative Molecular Mass | 1224.37 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000053745;LOC108351524 |
| Transcript ID/Name | ENSRNOT00000091728;LOC108351524-201 |
| Transcript Length | 382 |
| Coding Ability | 0.8272 |
| DNA Sequence Corresponding to Peptide | ATGAATGGGGAAGATGCGATCACTATAGTC |
|
Conservation
|
|
|