Basic information for LOC688442-201-10aa
| Peptide Name | LOC688442-201-10aa |
| Genome Position | chr10:1563576-1563605[+] |
| Species | Rat |
| Peptide Sequence | MSLSWETLII |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.18 |
| Relative Molecular Mass | 1354.58 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000053206;LOC688442 |
| Transcript ID/Name | ENSRNOT00000090214;LOC688442-201 |
| Transcript Length | 1393 |
| Coding Ability | 0.4286 |
| DNA Sequence Corresponding to Peptide | ATGAGCCTCTCCTGGGAGACCCTTATTATT |
|
Conservation
|
|
|