Basic information for MAP4K3-DT-217-10aa-1
| Peptide Name | MAP4K3-DT-217-10aa-1 |
| Genome Position | chr2:39602584-39602613[+] |
| Species | Human |
| Peptide Sequence | MWACSDFCLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.39 |
| Relative Molecular Mass | 1350.56 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000231312;MAP4K3-DT |
| Transcript ID/Name | ENST00000667600;MAP4K3-DT-217 |
| Transcript Length | 3990 |
| Coding Ability | 0.3576 |
| DNA Sequence Corresponding to Peptide | ATGTGGGCTTGTTCTGATTTTTGCTTATTA |
|
Conservation
|
|
|