Basic information for MINCR-207-10aa
| Peptide Name | MINCR-207-10aa |
| Genome Position | chr8:143281652-143281681[-] |
| Species | Human |
| Peptide Sequence | MYVKIKTLVN |
| Peptide Length | 10 |
| Unique | No (MINCR-201-10aa,MINCR-205-10aa) |
| Grand Average of Hydropathicity | 0.53 |
| Relative Molecular Mass | 1370.7 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000253716;MINCR |
| Transcript ID/Name | ENST00000671046;MINCR-207 |
| Transcript Length | 1527 |
| Coding Ability | 0.2358 |
| DNA Sequence Corresponding to Peptide | ATGTATGTAAAAATAAAAACGCTTGTGAAC |
m6A
|
Conservation
|
|
|