Basic information for MIR137HG-206-10aa-1
| Peptide Name | MIR137HG-206-10aa-1 |
| Genome Position | chr1:97986957-97986986[-] |
| Species | Human |
| Peptide Sequence | MLFTLLLLSC |
| Peptide Length | 10 |
| Unique | No (MIR137HG-202-10aa-3) |
| Grand Average of Hydropathicity | 2.47 |
| Relative Molecular Mass | 1315.66 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000225206;MIR137HG |
| Transcript ID/Name | ENST00000634594;MIR137HG-206 |
| Transcript Length | 3586 |
| Coding Ability | 0.3204 |
| DNA Sequence Corresponding to Peptide | ATGCTATTTACATTGTTACTACTTTCTTGT |
|
Conservation
|
|
|