Basic information for MIR4300HG-211-10aa
| Peptide Name | MIR4300HG-211-10aa |
| Genome Position | chr11:82289449-82289478[-] |
| Species | Human |
| Peptide Sequence | MFNYGNSVVQ |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.01 |
| Relative Molecular Mass | 1320.44 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000245832;MIR4300HG |
| Transcript ID/Name | ENST00000668723;MIR4300HG-211 |
| Transcript Length | 598 |
| Coding Ability | 0.3127 |
| DNA Sequence Corresponding to Peptide | ATGTTTAATTATGGGAACAGTGTTGTACAA |
|
Conservation
|
|
|