Basic information for MIR4300HG-214-10aa-3
| Peptide Name | MIR4300HG-214-10aa-3 |
| Genome Position | chr11:82672722-82672751[-] |
| Species | Human |
| Peptide Sequence | MVLKDTELVR |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.18 |
| Relative Molecular Mass | 1365.63 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000245832;MIR4300HG |
| Transcript ID/Name | ENST00000671287;MIR4300HG-214 |
| Transcript Length | 1982 |
| Coding Ability | 0.335 |
| DNA Sequence Corresponding to Peptide | ATGGTGCTCAAAGACACAGAGTTAGTAAGG |
|
Conservation
|
|
|