Basic information for MIR646HG-261-10aa-1
| Peptide Name | MIR646HG-261-10aa-1 |
| Genome Position | chr20:60559836-60559865[+] |
| Species | Human |
| Peptide Sequence | MGQLWFPVTL |
| Peptide Length | 10 |
| Unique | No (MIR646HG-266-10aa-2,MIR646HG-267-10aa-1) |
| Grand Average of Hydropathicity | 0.94 |
| Relative Molecular Mass | 1353.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000228340;MIR646HG |
| Transcript ID/Name | ENST00000665114;MIR646HG-261 |
| Transcript Length | 1250 |
| Coding Ability | 0.512 |
| DNA Sequence Corresponding to Peptide | ATGGGCCAACTCTGGTTCCCAGTGACATTG |
|
Conservation
|
|
|