Basic information for MYCBP2-AS1-210-10aa-1
| Peptide Name | MYCBP2-AS1-210-10aa-1 |
| Genome Position | chr13:77077627-77077656[+] |
| Species | Human |
| Peptide Sequence | MVELRIKIQA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.53 |
| Relative Molecular Mass | 1362.63 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000236051;MYCBP2-AS1 |
| Transcript ID/Name | ENST00000636737;MYCBP2-AS1-210 |
| Transcript Length | 1559 |
| Coding Ability | 0.4028 |
| DNA Sequence Corresponding to Peptide | ATGGTGGAATTGAGAATTAAAATCCAGGCC |
|
Conservation
|
|
|