Basic information for Mirt1-202-10aa
| Peptide Name | Mirt1-202-10aa |
| Genome Position | chr19:53444577-53444606[-] |
| Species | Mouse |
| Peptide Sequence | MPPIHCAPCS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.44 |
| Relative Molecular Mass | 1217.43 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000097636;Mirt1 |
| Transcript ID/Name | ENSMUST00000180667;Mirt1-202 |
| Transcript Length | 1711 |
| Coding Ability | 0.3735 |
| DNA Sequence Corresponding to Peptide | ATGCCTCCTATCCACTGTGCACCTTGCTCA |
m6A
|
Conservation
|
|
|