Basic information for Mirt1-206-10aa
| Peptide Name | Mirt1-206-10aa |
| Genome Position | chr19:53463026-53463055[-] |
| Species | Mouse |
| Peptide Sequence | MVTYVPLGFI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.74 |
| Relative Molecular Mass | 1301.59 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000097636;Mirt1 |
| Transcript ID/Name | ENSMUST00000237144;Mirt1-206 |
| Transcript Length | 1958 |
| Coding Ability | 0.3611 |
| DNA Sequence Corresponding to Peptide | ATGGTCACCTATGTTCCTTTAGGTTTTATT |
|
Conservation
|
|
|