Basic information for NEAT1-202-10aa-2
| Peptide Name | NEAT1-202-10aa-2 |
| Genome Position | chr11:65433976-65434005[+] |
| Species | Human |
| Peptide Sequence | MCFSEYIFIF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.62 |
| Relative Molecular Mass | 1461.69 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000245532;NEAT1 |
| Transcript ID/Name | ENST00000501122;NEAT1-202 |
| Transcript Length | 22743 |
| Coding Ability | 0.4242 |
| DNA Sequence Corresponding to Peptide | ATGTGTTTTTCAGAGTATATATTTATATTT |
|
Conservation
|
|
|