Basic information for NEAT1-209-10aa
| Peptide Name | NEAT1-209-10aa |
| Genome Position | chr11:65424282-65424311[+] |
| Species | Human |
| Peptide Sequence | MPAGTPPFLG |
| Peptide Length | 10 |
| Unique | No (NEAT1-201-10aa,NEAT1-202-10aa-3,NEAT1-203-10aa,NEAT1-204-10aa,NEAT1-206-10aa,NEAT1-207-10aa-2,NEAT1-208-10aa) |
| Grand Average of Hydropathicity | 0.4 |
| Relative Molecular Mass | 1149.35 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000245532;NEAT1 |
| Transcript ID/Name | ENST00000670617;NEAT1-209 |
| Transcript Length | 3301 |
| Coding Ability | 0.3263 |
| DNA Sequence Corresponding to Peptide | ATGCCAGCAGGCACCCCTCCTTTCCTGGGG |
m6A
|
Conservation
|
|
|