Basic information for NIPBL-DT-203-10aa-2
| Peptide Name | NIPBL-DT-203-10aa-2 |
| Genome Position | chr5:36875228-36875257[-] |
| Species | Human |
| Peptide Sequence | MDAFFHLGLF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.26 |
| Relative Molecular Mass | 1359.54 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000285967;NIPBL-DT |
| Transcript ID/Name | ENST00000649921;NIPBL-DT-203 |
| Transcript Length | 5337 |
| Coding Ability | 0.4478 |
| DNA Sequence Corresponding to Peptide | ATGGATGCCTTTTTTCATCTTGGCCTATTC |
m6A
|
Conservation
|
|
|