Basic information for NR2F1-AS1-250-10aa-4
| Peptide Name | NR2F1-AS1-250-10aa-4 |
| Genome Position | chr5:93457738-93457767[-] |
| Species | Human |
| Peptide Sequence | MLAAIGNSAL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.47 |
| Relative Molecular Mass | 1122.27 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000237187;NR2F1-AS1 |
| Transcript ID/Name | ENST00000663096;NR2F1-AS1-250 |
| Transcript Length | 2399 |
| Coding Ability | 0.4339 |
| DNA Sequence Corresponding to Peptide | ATGCTGGCGGCAATAGGCAATAGTGCTCTT |
|
Conservation
|
|
|