Basic information for PART1-201-10aa-3
| Peptide Name | PART1-201-10aa-3 |
| Genome Position | chr5:60524791-60524820[+] |
| Species | Human |
| Peptide Sequence | MCESPILRFA |
| Peptide Length | 10 |
| Unique | No (PART1-204-10aa-3) |
| Grand Average of Hydropathicity | 0.69 |
| Relative Molecular Mass | 1328.54 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000152931;PART1 |
| Transcript ID/Name | ENST00000504876;PART1-201 |
| Transcript Length | 5616 |
| Coding Ability | 0.4284 |
| DNA Sequence Corresponding to Peptide | ATGTGTGAAAGCCCCATTCTCAGATTTGCT |
|
Conservation
|
|
|