Basic information for PART1-202-10aa
| Peptide Name | PART1-202-10aa |
| Genome Position | chr5:60548543-60548572[+] |
| Species | Human |
| Peptide Sequence | MPASCGGSSL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.52 |
| Relative Molecular Mass | 1071.17 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000152931;PART1 |
| Transcript ID/Name | ENST00000506884;PART1-202 |
| Transcript Length | 3240 |
| Coding Ability | 0.409 |
| DNA Sequence Corresponding to Peptide | ATGCCAGCCAGTTGTGGTGGCTCAAGCCTG |
|
Conservation
|
|
|