Basic information for PTPRG-AS1-201-10aa-2
| Peptide Name | PTPRG-AS1-201-10aa-2 |
| Genome Position | chr3:62262606-62262635[-] |
| Species | Human |
| Peptide Sequence | MDQKAWRLII |
| Peptide Length | 10 |
| Unique | No (PTPRG-AS1-204-10aa-1,PTPRG-AS1-211-10aa-2,PTPRG-AS1-212-10aa-1,PTPRG-AS1-213-10aa-1,PTPRG-AS1-214-10aa-2,PTPRG-AS1-216-10aa-1,PTPRG-AS1-217-10aa-2,PTPRG-AS1-218-10aa-1,PTPRG-AS1-219-10aa-1,PTPRG-AS1-221-10aa-2,PTPRG-AS1-222-10aa-2,PTPRG-AS1-223-10aa-1,PTPRG-AS1-226-10aa-2) |
| Grand Average of Hydropathicity | 0.02 |
| Relative Molecular Mass | 1435.67 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000241472;PTPRG-AS1 |
| Transcript ID/Name | ENST00000462497;PTPRG-AS1-201 |
| Transcript Length | 2556 |
| Coding Ability | 0.3905 |
| DNA Sequence Corresponding to Peptide | ATGGACCAAAAGGCCTGGAGGCTCATCATT |
|
Conservation
|
|
|