Basic information for PTPRG-AS1-202-10aa
| Peptide Name | PTPRG-AS1-202-10aa |
| Genome Position | chr3:62276848-62276877[-] |
| Species | Human |
| Peptide Sequence | MVLEKSGLFH |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.47 |
| Relative Molecular Mass | 1322.53 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000241472;PTPRG-AS1 |
| Transcript ID/Name | ENST00000466893;PTPRG-AS1-202 |
| Transcript Length | 823 |
| Coding Ability | 0.2989 |
| DNA Sequence Corresponding to Peptide | ATGGTCTTAGAAAAGAGTGGCCTTTTTCAT |
|
Conservation
|
|
|