Basic information for PTPRG-AS1-212-10aa-2
| Peptide Name | PTPRG-AS1-212-10aa-2 |
| Genome Position | chr3:62263113-62263142[-] |
| Species | Human |
| Peptide Sequence | MYLFLCLFSG |
| Peptide Length | 10 |
| Unique | No (PTPRG-AS1-201-10aa-1,PTPRG-AS1-204-10aa-2,PTPRG-AS1-211-10aa-1,PTPRG-AS1-213-10aa-2,PTPRG-AS1-214-10aa-1,PTPRG-AS1-216-10aa-2,PTPRG-AS1-217-10aa-1,PTPRG-AS1-218-10aa-2,PTPRG-AS1-219-10aa-2,PTPRG-AS1-221-10aa-1,PTPRG-AS1-222-10aa-1,PTPRG-AS1-223-10aa-2,PTPRG-AS1-226-10aa-1) |
| Grand Average of Hydropathicity | 1.89 |
| Relative Molecular Mass | 1355.61 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000241472;PTPRG-AS1 |
| Transcript ID/Name | ENST00000652980;PTPRG-AS1-212 |
| Transcript Length | 2682 |
| Coding Ability | 0.4351 |
| DNA Sequence Corresponding to Peptide | ATGTATCTGTTTTTGTGCTTGTTTTCTGGA |
|
Conservation
|
|
|