Basic information for PTPRG-AS1-217-10aa-3
| Peptide Name | PTPRG-AS1-217-10aa-3 |
| Genome Position | chr3:62263328-62263357[-] |
| Species | Human |
| Peptide Sequence | MTLQLLDTVN |
| Peptide Length | 10 |
| Unique | No (PTPRG-AS1-211-10aa-3,PTPRG-AS1-222-10aa-3) |
| Grand Average of Hydropathicity | 0.56 |
| Relative Molecular Mass | 1309.56 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000241472;PTPRG-AS1 |
| Transcript ID/Name | ENST00000664200;PTPRG-AS1-217 |
| Transcript Length | 3451 |
| Coding Ability | 0.3947 |
| DNA Sequence Corresponding to Peptide | ATGACTCTCCAATTGTTGGACACTGTAAAT |
|
Conservation
|
|
|