Basic information for PTPRG-AS1-224-10aa
| Peptide Name | PTPRG-AS1-224-10aa |
| Genome Position | chr3:62292132-62292161[-] |
| Species | Human |
| Peptide Sequence | MNTDHLYFLF |
| Peptide Length | 10 |
| Unique | No (PTPRG-AS1-225-10aa) |
| Grand Average of Hydropathicity | 0.29 |
| Relative Molecular Mass | 1462.66 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000241472;PTPRG-AS1 |
| Transcript ID/Name | ENST00000669571;PTPRG-AS1-224 |
| Transcript Length | 2521 |
| Coding Ability | 0.5422 |
| DNA Sequence Corresponding to Peptide | ATGAATACTGACCATCTATATTTCCTCTTC |
|
Conservation
|
|
|