Basic information for Platr23-201-10aa
| Peptide Name | Platr23-201-10aa |
| Genome Position | chr1:136623442-136623471[-] |
| Species | Mouse |
| Peptide Sequence | MKHLIFLNSV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.96 |
| Relative Molecular Mass | 1363.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000097229;Platr23 |
| Transcript ID/Name | ENSMUST00000180797;Platr23-201 |
| Transcript Length | 2439 |
| Coding Ability | 0.3858 |
| DNA Sequence Corresponding to Peptide | ATGAAACACTTAATATTTCTAAACTCCGTC |
|
Conservation
|
|
|