Basic information for RBMS3-AS3-205-10aa-4
| Peptide Name | RBMS3-AS3-205-10aa-4 |
| Genome Position | chr3:29263622-29263651[-] |
| Species | Human |
| Peptide Sequence | MLKSLNSVIV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.34 |
| Relative Molecular Mass | 1265.51 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000235904;RBMS3-AS3 |
| Transcript ID/Name | ENST00000664598;RBMS3-AS3-205 |
| Transcript Length | 4161 |
| Coding Ability | 0.3925 |
| DNA Sequence Corresponding to Peptide | ATGCTCAAGTCCCTTAATAGTGTAATAGTG |
m6A
|
Conservation
|
|
|