Basic information for RGD1565989-202-10aa-1
| Peptide Name | RGD1565989-202-10aa-1 |
| Genome Position | chr2:127916137-127916166[+] |
| Species | Rat |
| Peptide Sequence | MCRWFAVRVF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.03 |
| Relative Molecular Mass | 1476.76 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000013940;RGD1565989 |
| Transcript ID/Name | ENSRNOT00000090861;RGD1565989-202 |
| Transcript Length | 1620 |
| Coding Ability | 0.2475 |
| DNA Sequence Corresponding to Peptide | ATGTGTCGTTGGTTTGCAGTCAGAGTGTTT |
|
Conservation
|
|
|