Basic information for RNASEH2B-AS1-211-10aa-3
| Peptide Name | RNASEH2B-AS1-211-10aa-3 |
| Genome Position | chr13:50880072-50880101[-] |
| Species | Human |
| Peptide Sequence | MALLSCISRS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.14 |
| Relative Molecular Mass | 1242.44 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000233672;RNASEH2B-AS1 |
| Transcript ID/Name | ENST00000660528;RNASEH2B-AS1-211 |
| Transcript Length | 2774 |
| Coding Ability | 0.3248 |
| DNA Sequence Corresponding to Peptide | ATGGCACTGTTATCTTGCATCTCCAGGTCC |
|
Conservation
|
|
|