Basic information for RTCA-AS1-206-10aa-1
| Peptide Name | RTCA-AS1-206-10aa-1 |
| Genome Position | chr1:100258507-100258536[-] |
| Species | Human |
| Peptide Sequence | MRSVLSFFLG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.28 |
| Relative Molecular Mass | 1318.53 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224616;RTCA-AS1 |
| Transcript ID/Name | ENST00000670421;RTCA-AS1-206 |
| Transcript Length | 7681 |
| Coding Ability | 0.383 |
| DNA Sequence Corresponding to Peptide | ATGCGGAGTGTGTTATCTTTCTTTCTAGGG |
|
Conservation
|
|
|