Basic information for Rapgef4os1-201-10aa
| Peptide Name | Rapgef4os1-201-10aa |
| Genome Position | chr2:72148692-72148721[-] |
| Species | Mouse |
| Peptide Sequence | MSFHLSSGSP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.01 |
| Relative Molecular Mass | 1211.29 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000085439;Rapgef4os1 |
| Transcript ID/Name | ENSMUST00000126462;Rapgef4os1-201 |
| Transcript Length | 638 |
| Coding Ability | 0.6411 |
| DNA Sequence Corresponding to Peptide | ATGAGTTTCCATTTGTCATCTGGAAGTCCC |
|
Conservation
|
|
|