Basic information for SCN1A-AS1-202-10aa-3
| Peptide Name | SCN1A-AS1-202-10aa-3 |
| Genome Position | chr2:166059449-166059478[+] |
| Species | Human |
| Peptide Sequence | MKFLPKIRLI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.74 |
| Relative Molecular Mass | 1420.79 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000236107;SCN1A-AS1 |
| Transcript ID/Name | ENST00000595268;SCN1A-AS1-202 |
| Transcript Length | 567 |
| Coding Ability | 0.2187 |
| DNA Sequence Corresponding to Peptide | ATGAAATTCCTTCCAAAAATTAGACTTATT |
|
Conservation
|
|
|