Basic information for SCN1A-AS1-215-10aa-1
| Peptide Name | SCN1A-AS1-215-10aa-1 |
| Genome Position | chr2:165980762-165980766,165984617-165984641[+] |
| Species | Human |
| Peptide Sequence | MRDFLVSIFS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.04 |
| Relative Molecular Mass | 1376.56 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000236107;SCN1A-AS1 |
| Transcript ID/Name | ENST00000651562;SCN1A-AS1-215 |
| Transcript Length | 2390 |
| Coding Ability | 0.282 |
| DNA Sequence Corresponding to Peptide | ATGAGGGACTTTCTGGTCTCCATATTCTCA |
|
Conservation
|
|
|