Basic information for SNHG11-231-10aa-1
| Peptide Name | SNHG11-231-10aa-1 |
| Genome Position | chr20:38447955-38447984[+] |
| Species | Human |
| Peptide Sequence | MGADEIFVLH |
| Peptide Length | 10 |
| Unique | No (SNHG11-202-10aa-1,SNHG11-203-10aa-1,SNHG11-206-10aa-1,SNHG11-209-10aa-1,SNHG11-210-10aa-2,SNHG11-219-10aa-1,SNHG11-221-10aa-2,SNHG11-222-10aa-1,SNHG11-223-10aa-1,SNHG11-224-10aa-1,SNHG11-225-10aa-2,SNHG11-226-10aa-2,SNHG11-227-10aa-2,SNHG11-229-10aa-3,SNHG11-230-10aa-1,SNHG11-232-10aa-1,SNHG11-235-10aa-1,SNHG11-238-10aa-2) |
| Grand Average of Hydropathicity | 0.84 |
| Relative Molecular Mass | 1293.44 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000174365;SNHG11 |
| Transcript ID/Name | ENST00000666350;SNHG11-231 |
| Transcript Length | 1299 |
| Coding Ability | 0.5681 |
| DNA Sequence Corresponding to Peptide | ATGGGGGCAGATGAGATCTTTGTACTGCAT |
|
Conservation
|
|
|