Basic information for SNHG11-237-10aa-1
| Peptide Name | SNHG11-237-10aa-1 |
| Genome Position | chr20:38449655-38449684[+] |
| Species | Human |
| Peptide Sequence | MVEKACVNYF |
| Peptide Length | 10 |
| Unique | No (SNHG11-223-10aa-2,SNHG11-228-10aa-1,SNHG11-229-10aa-2) |
| Grand Average of Hydropathicity | 0.52 |
| Relative Molecular Mass | 1365.58 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000174365;SNHG11 |
| Transcript ID/Name | ENST00000669976;SNHG11-237 |
| Transcript Length | 3118 |
| Coding Ability | 0.3894 |
| DNA Sequence Corresponding to Peptide | ATGGTGGAGAAAGCCTGTGTGAATTATTTT |
|
Conservation
|
|
|