Basic information for SNHG12-204-10aa
| Peptide Name | SNHG12-204-10aa |
| Genome Position | chr1:28580895-28580924[-] |
| Species | Human |
| Peptide Sequence | MTVVLILLSR |
| Peptide Length | 10 |
| Unique | No (SNHG12-206-10aa,SNHG12-209-10aa,SNHG12-214-10aa) |
| Grand Average of Hydropathicity | 2.02 |
| Relative Molecular Mass | 1306.64 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000197989;SNHG12 |
| Transcript ID/Name | ENST00000464612;SNHG12-204 |
| Transcript Length | 719 |
| Coding Ability | 0.4131 |
| DNA Sequence Corresponding to Peptide | ATGACAGTTGTTCTCATTTTGCTGTCCAGA |
m6A
|
Conservation
|
|
|