Basic information for SNHG14-203-10aa-1
| Peptide Name | SNHG14-203-10aa-1 |
| Genome Position | chr15:25197431-25197460[+] |
| Species | Human |
| Peptide Sequence | MSLSQVLSPW |
| Peptide Length | 10 |
| Unique | No (SNHG14-202-10aa-2,SNHG14-244-10aa-1) |
| Grand Average of Hydropathicity | 0.53 |
| Relative Molecular Mass | 1309.47 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000424333;SNHG14-203 |
| Transcript Length | 7315 |
| Coding Ability | 0.435 |
| DNA Sequence Corresponding to Peptide | ATGTCCCTCAGCCAGGTGCTTAGCCCCTGG |
|
Conservation
|
|
|