Basic information for SNHG14-208-10aa-3
| Peptide Name | SNHG14-208-10aa-3 |
| Genome Position | chr15:25104519-25104548[+] |
| Species | Human |
| Peptide Sequence | MGWSLCCWSP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.53 |
| Relative Molecular Mass | 1331.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000546682;SNHG14-208 |
| Transcript Length | 8842 |
| Coding Ability | 0.4338 |
| DNA Sequence Corresponding to Peptide | ATGGGCTGGTCATTGTGCTGCTGGTCTCCA |
|
Conservation
|
|
|