Basic information for SNHG14-210-10aa-2
| Peptide Name | SNHG14-210-10aa-2 |
| Genome Position | chr15:25128802-25128831[+] |
| Species | Human |
| Peptide Sequence | MLCLGANRPL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.76 |
| Relative Molecular Mass | 1249.49 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000549804;SNHG14-210 |
| Transcript Length | 24124 |
| Coding Ability | 0.3996 |
| DNA Sequence Corresponding to Peptide | ATGTTATGTCTGGGGGCAAATAGACCACTT |
|
Conservation
|
|
|