Basic information for SNHG14-220-10aa-8
| Peptide Name | SNHG14-220-10aa-8 |
| Genome Position | chr15:24990874-24990903[+] |
| Species | Human |
| Peptide Sequence | MLNSATCLIS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.25 |
| Relative Molecular Mass | 1214.43 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000557108;SNHG14-220 |
| Transcript Length | 11177 |
| Coding Ability | 0.3651 |
| DNA Sequence Corresponding to Peptide | ATGTTGAATTCAGCTACATGCCTCATCAGC |
m6A
|
Conservation
|
|
|