Basic information for SNHG14-221-10aa-2
| Peptide Name | SNHG14-221-10aa-2 |
| Genome Position | chr15:25418181-25418210[+] |
| Species | Human |
| Peptide Sequence | MTIVNYDLVD |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.61 |
| Relative Molecular Mass | 1344.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000580438;SNHG14-221 |
| Transcript Length | 1512 |
| Coding Ability | 0.3247 |
| DNA Sequence Corresponding to Peptide | ATGACTATTGTCAACTATGATCTCGTTGAC |
|
Conservation
|
|
|