Basic information for SNHG14-242-10aa-2
| Peptide Name | SNHG14-242-10aa-2 |
| Genome Position | chr15:25086673-25086702[+] |
| Species | Human |
| Peptide Sequence | MGCIKGSIQA |
| Peptide Length | 10 |
| Unique | No (SNHG14-283-10aa-4) |
| Grand Average of Hydropathicity | 0.62 |
| Relative Molecular Mass | 1169.37 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000655993;SNHG14-242 |
| Transcript Length | 7238 |
| Coding Ability | 0.4135 |
| DNA Sequence Corresponding to Peptide | ATGGGTTGCATCAAGGGGTCCATCCAGGCT |
|
Conservation
|
|
|