Basic information for SNHG14-247-10aa-3
| Peptide Name | SNHG14-247-10aa-3 |
| Genome Position | chr15:25265836-25265865[+] |
| Species | Human |
| Peptide Sequence | MVSPCWSGCS |
| Peptide Length | 10 |
| Unique | No (SNHG14-259-10aa-1,SNHG14-296-10aa-2) |
| Grand Average of Hydropathicity | 0.58 |
| Relative Molecular Mass | 1218.37 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000656474;SNHG14-247 |
| Transcript Length | 1945 |
| Coding Ability | 0.3275 |
| DNA Sequence Corresponding to Peptide | ATGGTTTCACCATGTTGGTCAGGCTGTTCT |
|
Conservation
|
|
|