Basic information for SNHG14-259-10aa-3
| Peptide Name | SNHG14-259-10aa-3 |
| Genome Position | chr15:25266210-25266239[+] |
| Species | Human |
| Peptide Sequence | MGCFVSAENH |
| Peptide Length | 10 |
| Unique | No (SNHG14-247-10aa-2,SNHG14-296-10aa-3,SNHG14-337-10aa-1) |
| Grand Average of Hydropathicity | 0.18 |
| Relative Molecular Mass | 1256.37 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000658502;SNHG14-259 |
| Transcript Length | 2094 |
| Coding Ability | 0.352 |
| DNA Sequence Corresponding to Peptide | ATGGGATGTTTTGTTTCTGCAGAAAACCAC |
|
Conservation
|
|
|