Basic information for SNHG14-274-10aa-1
| Peptide Name | SNHG14-274-10aa-1 |
| Genome Position | chr15:25102784-25102813[+] |
| Species | Human |
| Peptide Sequence | MSLFSCLLAA |
| Peptide Length | 10 |
| Unique | No (SNHG14-255-10aa-4,SNHG14-276-10aa-1) |
| Grand Average of Hydropathicity | 2.06 |
| Relative Molecular Mass | 1217.43 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000661389;SNHG14-274 |
| Transcript Length | 7757 |
| Coding Ability | 0.4374 |
| DNA Sequence Corresponding to Peptide | ATGAGCCTTTTTTCATGTTTGTTGGCTGCA |
|
Conservation
|
|
|