Basic information for SNHG14-274-10aa-2
| Peptide Name | SNHG14-274-10aa-2 |
| Genome Position | chr15:25103552-25103581[+] |
| Species | Human |
| Peptide Sequence | MPIVHSARCV |
| Peptide Length | 10 |
| Unique | No (SNHG14-237-10aa-1,SNHG14-255-10aa-5,SNHG14-276-10aa-2,SNHG14-302-10aa-3) |
| Grand Average of Hydropathicity | 0.9 |
| Relative Molecular Mass | 1274.51 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000661389;SNHG14-274 |
| Transcript Length | 7757 |
| Coding Ability | 0.4374 |
| DNA Sequence Corresponding to Peptide | ATGCCAATAGTGCACAGTGCTCGCTGTGTT |
|
Conservation
|
|
|