Basic information for SNHG14-287-10aa-1
| Peptide Name | SNHG14-287-10aa-1 |
| Genome Position | chr15:25095343-25095372[+] |
| Species | Human |
| Peptide Sequence | MVLQHSLFLF |
| Peptide Length | 10 |
| Unique | No (SNHG14-275-10aa-1,SNHG14-297-10aa-4,SNHG14-315-10aa-5,SNHG14-324-10aa-6) |
| Grand Average of Hydropathicity | 1.56 |
| Relative Molecular Mass | 1396.65 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000663612;SNHG14-287 |
| Transcript Length | 7339 |
| Coding Ability | 0.4255 |
| DNA Sequence Corresponding to Peptide | ATGGTTTTGCAACATAGCCTCTTCTTATTT |
|
Conservation
|
|
|