Basic information for SNHG14-297-10aa-1
| Peptide Name | SNHG14-297-10aa-1 |
| Genome Position | chr15:25091091-25091120[+] |
| Species | Human |
| Peptide Sequence | MWDSVCLVVL |
| Peptide Length | 10 |
| Unique | No (SNHG14-315-10aa-1,SNHG14-324-10aa-1) |
| Grand Average of Hydropathicity | 1.94 |
| Relative Molecular Mass | 1326.57 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000665547;SNHG14-297 |
| Transcript Length | 7140 |
| Coding Ability | 0.4581 |
| DNA Sequence Corresponding to Peptide | ATGTGGGATTCAGTGTGTCTGGTGGTCCTC |
|
Conservation
|
|
|