Basic information for SNHG14-303-10aa-4
| Peptide Name | SNHG14-303-10aa-4 |
| Genome Position | chr15:25085995-25086024[+] |
| Species | Human |
| Peptide Sequence | MRLWLILIPV |
| Peptide Length | 10 |
| Unique | No (SNHG14-278-10aa-3) |
| Grand Average of Hydropathicity | 1.95 |
| Relative Molecular Mass | 1415.76 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000666022;SNHG14-303 |
| Transcript Length | 5055 |
| Coding Ability | 0.4669 |
| DNA Sequence Corresponding to Peptide | ATGAGACTCTGGCTTATCCTGATCCCGGTG |
|
Conservation
|
|
|