Basic information for SNHG14-310-10aa-3
| Peptide Name | SNHG14-310-10aa-3 |
| Genome Position | chr15:25112558-25112587[+] |
| Species | Human |
| Peptide Sequence | MASVSFGNLD |
| Peptide Length | 10 |
| Unique | No (SNHG14-208-10aa-4,SNHG14-270-10aa-1,SNHG14-316-10aa-1,SNHG14-338-10aa-4) |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1202.28 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000667478;SNHG14-310 |
| Transcript Length | 4682 |
| Coding Ability | 0.4329 |
| DNA Sequence Corresponding to Peptide | ATGGCTTCAGTATCTTTTGGAAATCTGGAC |
|
Conservation
|
|
|