Basic information for SNHG14-315-10aa-3
| Peptide Name | SNHG14-315-10aa-3 |
| Genome Position | chr15:25086357-25086386[+] |
| Species | Human |
| Peptide Sequence | MLVRDNCYLV |
| Peptide Length | 10 |
| Unique | No (AC124312.3-201-10aa-2,SNHG14-224-10aa-2,SNHG14-278-10aa-1,SNHG14-303-10aa-3) |
| Grand Average of Hydropathicity | 0.76 |
| Relative Molecular Mass | 1387.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000668419;SNHG14-315 |
| Transcript Length | 8232 |
| Coding Ability | 0.4425 |
| DNA Sequence Corresponding to Peptide | ATGTTGGTGAGGGACAATTGTTATCTTGTG |
|
Conservation
|
|
|