Basic information for SNHG14-332-10aa-1
| Peptide Name | SNHG14-332-10aa-1 |
| Genome Position | chr15:25077240-25077269[+] |
| Species | Human |
| Peptide Sequence | MQASGLFGLL |
| Peptide Length | 10 |
| Unique | No (SNHG14-313-10aa-3) |
| Grand Average of Hydropathicity | 1.28 |
| Relative Molecular Mass | 1198.38 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000670394;SNHG14-332 |
| Transcript Length | 8415 |
| Coding Ability | 0.4235 |
| DNA Sequence Corresponding to Peptide | ATGCAAGCGTCTGGGCTTTTTGGACTTCTG |
|
Conservation
|
|
|